Journal: Journal of Inflammation (London, England)

Article Title: Increased adipose tissue expression of TLR8 in obese individuals with or without type-2 diabetes: significance in metabolic inflammation

doi: 10.1186/s12950-016-0147-y

Figure Lengend Snippet: Elevated TLR8 protein expression in the adipose tissue samples from obese and overweight non-diabetic individuals. TLR8 protein expression in the subcutaneous adipose tissue samples from 15 non-diabetic individuals comprising lean, overweight and obese, five each, was detected by immunohistochemistry (IHC) and confirmed by confocal microscopy as described in Methods. TLR8 protein expression in the adipose tissue samples was quantified using Aperio ImageScope software (Aperio Vista, CA, USA) and algorithm (version 9); on average, 700 cells were counted for each sample. The representative data from three independent determinations are shown. TLR8 protein expression is shown by using ( a ) immunohistochemistry ( arrows ); and ( b ) confocal microscopy where red color represents TLR8-specific staining and blue color represents nuclei staining (40× magnification). c TLR8 protein expression quantified as IHC staining intensity shows significantly higher expression in obese ( P = 0.005) and overweight ( P = 0.01) individuals as compared with lean counterparts. ( d ) The adipose tissue TLR8 protein expression in non-diabetics correlates with BMI ( r = 0.64 P = 0.01)

Article Snippet: For quantitative analysis of TLR8 protein expression, the entire adipose tissue sections (100×; Panoramic Scan, 3D-HISTECH, Hungary) were used to quantify immunohistochemical staining in all subdivided sample regions that were outlined using Aperio ImageScope software (Aperio Vista, CA, USA).

Techniques: Expressing, Immunohistochemistry, Confocal Microscopy, Software, Staining

Journal: Journal of Inflammation (London, England)

Article Title: Increased adipose tissue expression of TLR8 in obese individuals with or without type-2 diabetes: significance in metabolic inflammation

doi: 10.1186/s12950-016-0147-y

Figure Lengend Snippet: Increased TLR8 protein expression in the adipose tissue samples from obese and overweight type-2 diabetic (T2D) individuals. TLR8 protein expression in the subcutaneous adipose tissue samples from 13 T2D patients comprising three lean, five overweight and five obese individuals was detected by immunohistochemistry (IHC) and confirmed by confocal microscopy as described in Methods. TLR8 protein expression in the adipose tissue samples was quantified by using Aperio ImageScope software (Aperio Vista, CA, USA) and algorithm (version 9); while on average, 700 cells were counted for each sample. The representative data from three independent determinations are shown. TLR8 protein expression is shown by using ( a ) immunohistochemistry ( arrows ); ( b ) confocal microscopy wherein red color represents TLR8-specific staining and blue color represents nuclei staining (40× magnification). ( c ) TLR8 protein expression quantified as IHC staining intensity shows significantly higher expression in obese ( P = 0.0001) and overweight ( P = 0.003) individuals as compared with lean counterparts. ( d ) The adipose tissue TLR8 protein expression in T2D patients correlates with BMI ( r = 0.87 P < 0.0001)

Article Snippet: For quantitative analysis of TLR8 protein expression, the entire adipose tissue sections (100×; Panoramic Scan, 3D-HISTECH, Hungary) were used to quantify immunohistochemical staining in all subdivided sample regions that were outlined using Aperio ImageScope software (Aperio Vista, CA, USA).

Techniques: Expressing, Immunohistochemistry, Confocal Microscopy, Software, Staining

Journal: Cell reports

Article Title: Senescence, Necrosis, and Apoptosis Govern Circulating Cell-free DNA Release Kinetics.

doi: 10.1016/j.celrep.2020.107830

Figure Lengend Snippet: Figure 1. Early Release of cfDNA Is Mediated by Treatment-Specific Induction of Apoptosis (A) Experimental schema for (B), (C), (G), and (H). Human papillomavirus (HPV)-positive and -negative HNSCC cell lines and NSCLC cell lines are indicated in each panel. (B and C) Cells were treated with 0.5 mM staurosporine, and caspase activity (B) and cfDNA release (D) were measured. (B) Data represent fold change in caspase activity from control cells, as measured by luminescent caspase activation assay at indicated times in (A). (C) Data represent fold change in cfDNA release from control cells, as measured by qPCR assay using hLINE-1 primers at indicated times in (A). (D) Following pretreatment with z-vad-fmk, Cal33 and HMS-001 cells were treated with 0.5 mM staurosporine, and cfDNA release was measured. Shown is the fold change in cfDNA release post-treatment to control cells. Data represent mean values ± SEM. (E) The effect of 0.5 mM staurosporine and 10 mM ionomycin on proliferation (% confluence) in Cal33 and HMS-001 cells monitored by the IncuCyte live-imaging system. Grey dashed line indicates the time of treatment initiation. (F) Fold change in cfDNA release post-ionomycin treatment to control cells in Cal33 and HMS-001 cells. (G and H) Cells were treated with 8 Gy IR, and caspase activity (G) and cfDNA release (H) were measured. Data represent fold change in caspase activity (G) and cfDNA release from control cells (H), as described above (B and C). (B, C, and F–H) Data represent mean values ± SD; representative experiment is shown (n = 2–3). *p < 0.05, **p < 0.01, ***p < 0.001; ns, not significant; unpaired Student’s t test (D). See also Figure S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides short human LINE-1 Forward Primer: TCACTCAAAGCCGCTCAACTAC Eurofins Genomics N/A short human LINE-1 Reverse Primer: TCTGCCTTCATTTCGTTATGTACC Eurofins Genomics N/A long human LINE-1 Forward Primer TCTGCCTTCATTTCGTTATGTACC Eurofins Genomics N/A long human LINE-1 Reverse Primer TCAGCACCACACCACACCTATTC Eurofins Genomics N/A Recombinant DNA Plasmid: pBABE-puro-HrasV12 Addgene Cat#9041 Plasmid: pBABE-puro Addgene Cat#1764 pCL-10A1 Dr. Rama Khokha, Novusbio Cat# NBP2-29542 Software and Algorithms Graphpad Prism v8.1.1 GraphPad https://www.graphpad.com/ scientific-software/prism/ Infinity Analyze Lumenera https://www.lumenera.com/ infinity-analyze-and-capture-for-windows. html HALO Indica Labs https://www.indicalab.com/halo/ Aperio ImageScope Leica Biosystems https://www.leicabiosystems.com/ digital-pathology/manage/ aperio-imagescope/ IncuCyte Zoom Essen Instruments https://www.essenbioscience.com/en/ products/incucyte/

Techniques: Activity Assay, Control, Caspase Activity Assay, Imaging